ID: 937229312

View in Genome Browser
Species Human (GRCh38)
Location 2:120388316-120388338
Sequence TTGAAGGATAATGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937229307_937229312 5 Left 937229307 2:120388288-120388310 CCTAGAAGAGGGGACATCTGAAC No data
Right 937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937229312 Original CRISPR TTGAAGGATAATGAGGAGGA AGG Intergenic
No off target data available for this crispr