ID: 937236189

View in Genome Browser
Species Human (GRCh38)
Location 2:120433106-120433128
Sequence CTGTGGGACCCGCAGTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937236174_937236189 15 Left 937236174 2:120433068-120433090 CCTACTCCCTGATGGGGCCAGCC No data
Right 937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG No data
937236173_937236189 16 Left 937236173 2:120433067-120433089 CCCTACTCCCTGATGGGGCCAGC No data
Right 937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG No data
937236176_937236189 9 Left 937236176 2:120433074-120433096 CCCTGATGGGGCCAGCCTGGAAG No data
Right 937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG No data
937236182_937236189 -6 Left 937236182 2:120433089-120433111 CCTGGAAGGAGGGCAGCCTGTGG No data
Right 937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG No data
937236177_937236189 8 Left 937236177 2:120433075-120433097 CCTGATGGGGCCAGCCTGGAAGG No data
Right 937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG No data
937236181_937236189 -2 Left 937236181 2:120433085-120433107 CCAGCCTGGAAGGAGGGCAGCCT No data
Right 937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937236189 Original CRISPR CTGTGGGACCCGCAGTCAGG GGG Intergenic
No off target data available for this crispr