ID: 937237889

View in Genome Browser
Species Human (GRCh38)
Location 2:120441809-120441831
Sequence GAGGCCAGGTCTTTGGTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937237889_937237903 9 Left 937237889 2:120441809-120441831 CCCCATACCAAAGACCTGGCCTC No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237889_937237904 13 Left 937237889 2:120441809-120441831 CCCCATACCAAAGACCTGGCCTC No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237889_937237902 8 Left 937237889 2:120441809-120441831 CCCCATACCAAAGACCTGGCCTC No data
Right 937237902 2:120441840-120441862 TGGGAGATGCCCCACCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937237889 Original CRISPR GAGGCCAGGTCTTTGGTATG GGG (reversed) Intergenic
No off target data available for this crispr