ID: 937237903

View in Genome Browser
Species Human (GRCh38)
Location 2:120441841-120441863
Sequence GGGAGATGCCCCACCTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937237889_937237903 9 Left 937237889 2:120441809-120441831 CCCCATACCAAAGACCTGGCCTC No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237887_937237903 15 Left 937237887 2:120441803-120441825 CCAACACCCCATACCAAAGACCT No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237891_937237903 7 Left 937237891 2:120441811-120441833 CCATACCAAAGACCTGGCCTCCT No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237896_937237903 -5 Left 937237896 2:120441823-120441845 CCTGGCCTCCTGGCCCCTGGGAG No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237890_937237903 8 Left 937237890 2:120441810-120441832 CCCATACCAAAGACCTGGCCTCC No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237893_937237903 2 Left 937237893 2:120441816-120441838 CCAAAGACCTGGCCTCCTGGCCC No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237885_937237903 19 Left 937237885 2:120441799-120441821 CCCTCCAACACCCCATACCAAAG No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237886_937237903 18 Left 937237886 2:120441800-120441822 CCTCCAACACCCCATACCAAAGA No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data
937237897_937237903 -10 Left 937237897 2:120441828-120441850 CCTCCTGGCCCCTGGGAGATGCC No data
Right 937237903 2:120441841-120441863 GGGAGATGCCCCACCTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937237903 Original CRISPR GGGAGATGCCCCACCTTTTA GGG Intergenic
No off target data available for this crispr