ID: 937237904

View in Genome Browser
Species Human (GRCh38)
Location 2:120441845-120441867
Sequence GATGCCCCACCTTTTAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937237889_937237904 13 Left 937237889 2:120441809-120441831 CCCCATACCAAAGACCTGGCCTC No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237897_937237904 -6 Left 937237897 2:120441828-120441850 CCTCCTGGCCCCTGGGAGATGCC No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237896_937237904 -1 Left 937237896 2:120441823-120441845 CCTGGCCTCCTGGCCCCTGGGAG No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237887_937237904 19 Left 937237887 2:120441803-120441825 CCAACACCCCATACCAAAGACCT No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237886_937237904 22 Left 937237886 2:120441800-120441822 CCTCCAACACCCCATACCAAAGA No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237891_937237904 11 Left 937237891 2:120441811-120441833 CCATACCAAAGACCTGGCCTCCT No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237898_937237904 -9 Left 937237898 2:120441831-120441853 CCTGGCCCCTGGGAGATGCCCCA No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237885_937237904 23 Left 937237885 2:120441799-120441821 CCCTCCAACACCCCATACCAAAG No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237893_937237904 6 Left 937237893 2:120441816-120441838 CCAAAGACCTGGCCTCCTGGCCC No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data
937237890_937237904 12 Left 937237890 2:120441810-120441832 CCCATACCAAAGACCTGGCCTCC No data
Right 937237904 2:120441845-120441867 GATGCCCCACCTTTTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937237904 Original CRISPR GATGCCCCACCTTTTAGGGA AGG Intergenic
No off target data available for this crispr