ID: 937239246

View in Genome Browser
Species Human (GRCh38)
Location 2:120449735-120449757
Sequence CTGAAGTCCTTGATGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937239244_937239246 -6 Left 937239244 2:120449718-120449740 CCTGCCTTGGTTTCAGGCTGAAG No data
Right 937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG No data
937239241_937239246 15 Left 937239241 2:120449697-120449719 CCAAATCGGCTTCTCTTCATGCC No data
Right 937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG No data
937239239_937239246 17 Left 937239239 2:120449695-120449717 CCCCAAATCGGCTTCTCTTCATG No data
Right 937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG No data
937239245_937239246 -10 Left 937239245 2:120449722-120449744 CCTTGGTTTCAGGCTGAAGTCCT No data
Right 937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG No data
937239240_937239246 16 Left 937239240 2:120449696-120449718 CCCAAATCGGCTTCTCTTCATGC No data
Right 937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937239246 Original CRISPR CTGAAGTCCTTGATGCAAGA AGG Intergenic
No off target data available for this crispr