ID: 937244471

View in Genome Browser
Species Human (GRCh38)
Location 2:120483685-120483707
Sequence GAAGCTGGTGCTCCAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937244462_937244471 20 Left 937244462 2:120483642-120483664 CCCAGCATGGTCTTCACGCCCAC No data
Right 937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG No data
937244461_937244471 26 Left 937244461 2:120483636-120483658 CCTGAACCCAGCATGGTCTTCAC No data
Right 937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG No data
937244467_937244471 -2 Left 937244467 2:120483664-120483686 CCAAATGGCTTTCCCTGAGAAGA No data
Right 937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG No data
937244463_937244471 19 Left 937244463 2:120483643-120483665 CCAGCATGGTCTTCACGCCCACC No data
Right 937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG No data
937244465_937244471 2 Left 937244465 2:120483660-120483682 CCCACCAAATGGCTTTCCCTGAG No data
Right 937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG No data
937244466_937244471 1 Left 937244466 2:120483661-120483683 CCACCAAATGGCTTTCCCTGAGA No data
Right 937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937244471 Original CRISPR GAAGCTGGTGCTCCAGAAGC TGG Intergenic
No off target data available for this crispr