ID: 937244490

View in Genome Browser
Species Human (GRCh38)
Location 2:120483759-120483781
Sequence CGTGGGGAGGCCATCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937244480_937244490 -1 Left 937244480 2:120483737-120483759 CCCCACATGCTCTCTCTCCCTGC No data
Right 937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG No data
937244478_937244490 16 Left 937244478 2:120483720-120483742 CCATCAGAGCATGTCCACCCCAC No data
Right 937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG No data
937244482_937244490 -3 Left 937244482 2:120483739-120483761 CCACATGCTCTCTCTCCCTGCGT No data
Right 937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG No data
937244481_937244490 -2 Left 937244481 2:120483738-120483760 CCCACATGCTCTCTCTCCCTGCG No data
Right 937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG No data
937244477_937244490 23 Left 937244477 2:120483713-120483735 CCTGGGGCCATCAGAGCATGTCC No data
Right 937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG No data
937244479_937244490 2 Left 937244479 2:120483734-120483756 CCACCCCACATGCTCTCTCTCCC No data
Right 937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937244490 Original CRISPR CGTGGGGAGGCCATCATCAT GGG Intergenic
No off target data available for this crispr