ID: 937245180

View in Genome Browser
Species Human (GRCh38)
Location 2:120487961-120487983
Sequence CCTGAGGTGCCGGCCAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937245180_937245188 7 Left 937245180 2:120487961-120487983 CCCGCGCTGGCCGGCACCTCAGG No data
Right 937245188 2:120487991-120488013 AAGCATCTCTTCCTGGCAGCCGG No data
937245180_937245189 8 Left 937245180 2:120487961-120487983 CCCGCGCTGGCCGGCACCTCAGG No data
Right 937245189 2:120487992-120488014 AGCATCTCTTCCTGGCAGCCGGG No data
937245180_937245185 0 Left 937245180 2:120487961-120487983 CCCGCGCTGGCCGGCACCTCAGG No data
Right 937245185 2:120487984-120488006 CTCCCAGAAGCATCTCTTCCTGG No data
937245180_937245190 13 Left 937245180 2:120487961-120487983 CCCGCGCTGGCCGGCACCTCAGG No data
Right 937245190 2:120487997-120488019 CTCTTCCTGGCAGCCGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937245180 Original CRISPR CCTGAGGTGCCGGCCAGCGC GGG (reversed) Intergenic
No off target data available for this crispr