ID: 937246307

View in Genome Browser
Species Human (GRCh38)
Location 2:120496299-120496321
Sequence TGCCTCTGTGAAGTGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937246304_937246307 13 Left 937246304 2:120496263-120496285 CCTGCACTGATAATACGTTCAAA No data
Right 937246307 2:120496299-120496321 TGCCTCTGTGAAGTGGGATGAGG No data
937246303_937246307 14 Left 937246303 2:120496262-120496284 CCCTGCACTGATAATACGTTCAA No data
Right 937246307 2:120496299-120496321 TGCCTCTGTGAAGTGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937246307 Original CRISPR TGCCTCTGTGAAGTGGGATG AGG Intergenic
No off target data available for this crispr