ID: 937247798

View in Genome Browser
Species Human (GRCh38)
Location 2:120504666-120504688
Sequence TTGAGTCAACAGGTAGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937247798_937247803 -7 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247803 2:120504682-120504704 GACTCAAGGGCTGTGTGGAAAGG No data
937247798_937247809 24 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data
937247798_937247806 3 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data
937247798_937247807 8 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247807 2:120504697-120504719 TGGAAAGGGGTCAGTCGGTCTGG No data
937247798_937247808 19 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data
937247798_937247805 -5 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247805 2:120504684-120504706 CTCAAGGGCTGTGTGGAAAGGGG No data
937247798_937247804 -6 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247804 2:120504683-120504705 ACTCAAGGGCTGTGTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937247798 Original CRISPR TTGAGTCAACAGGTAGCTTA AGG (reversed) Intergenic
No off target data available for this crispr