ID: 937247801

View in Genome Browser
Species Human (GRCh38)
Location 2:120504676-120504698
Sequence CACACAGCCCTTGAGTCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937247801_937247809 14 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data
937247801_937247811 25 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247811 2:120504724-120504746 CAGACGGCAAGGCCACCACAGGG No data
937247801_937247810 24 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247810 2:120504723-120504745 GCAGACGGCAAGGCCACCACAGG No data
937247801_937247808 9 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data
937247801_937247807 -2 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247807 2:120504697-120504719 TGGAAAGGGGTCAGTCGGTCTGG No data
937247801_937247806 -7 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937247801 Original CRISPR CACACAGCCCTTGAGTCAAC AGG (reversed) Intergenic
No off target data available for this crispr