ID: 937247802

View in Genome Browser
Species Human (GRCh38)
Location 2:120504677-120504699
Sequence CTGTTGACTCAAGGGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937247791_937247802 26 Left 937247791 2:120504628-120504650 CCACTGTCCCACACAAAGACTTG No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data
937247795_937247802 -7 Left 937247795 2:120504661-120504683 CCCCACCTTAAGCTACCTGTTGA No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data
937247796_937247802 -8 Left 937247796 2:120504662-120504684 CCCACCTTAAGCTACCTGTTGAC No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data
937247793_937247802 18 Left 937247793 2:120504636-120504658 CCACACAAAGACTTGCTCCTCTG No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data
937247794_937247802 1 Left 937247794 2:120504653-120504675 CCTCTGTTCCCCACCTTAAGCTA No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data
937247797_937247802 -9 Left 937247797 2:120504663-120504685 CCACCTTAAGCTACCTGTTGACT No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data
937247792_937247802 19 Left 937247792 2:120504635-120504657 CCCACACAAAGACTTGCTCCTCT No data
Right 937247802 2:120504677-120504699 CTGTTGACTCAAGGGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937247802 Original CRISPR CTGTTGACTCAAGGGCTGTG TGG Intergenic
No off target data available for this crispr