ID: 937247806

View in Genome Browser
Species Human (GRCh38)
Location 2:120504692-120504714
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937247798_937247806 3 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data
937247795_937247806 8 Left 937247795 2:120504661-120504683 CCCCACCTTAAGCTACCTGTTGA No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data
937247796_937247806 7 Left 937247796 2:120504662-120504684 CCCACCTTAAGCTACCTGTTGAC No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data
937247794_937247806 16 Left 937247794 2:120504653-120504675 CCTCTGTTCCCCACCTTAAGCTA No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data
937247797_937247806 6 Left 937247797 2:120504663-120504685 CCACCTTAAGCTACCTGTTGACT No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data
937247801_937247806 -7 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr