ID: 937247808

View in Genome Browser
Species Human (GRCh38)
Location 2:120504708-120504730
Sequence CAGTCGGTCTGGCGAGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937247801_937247808 9 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data
937247796_937247808 23 Left 937247796 2:120504662-120504684 CCCACCTTAAGCTACCTGTTGAC No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data
937247797_937247808 22 Left 937247797 2:120504663-120504685 CCACCTTAAGCTACCTGTTGACT No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data
937247798_937247808 19 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data
937247795_937247808 24 Left 937247795 2:120504661-120504683 CCCCACCTTAAGCTACCTGTTGA No data
Right 937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937247808 Original CRISPR CAGTCGGTCTGGCGAGCAGA CGG Intergenic
No off target data available for this crispr