ID: 937247809

View in Genome Browser
Species Human (GRCh38)
Location 2:120504713-120504735
Sequence GGTCTGGCGAGCAGACGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937247801_937247809 14 Left 937247801 2:120504676-120504698 CCTGTTGACTCAAGGGCTGTGTG No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data
937247797_937247809 27 Left 937247797 2:120504663-120504685 CCACCTTAAGCTACCTGTTGACT No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data
937247798_937247809 24 Left 937247798 2:120504666-120504688 CCTTAAGCTACCTGTTGACTCAA No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data
937247796_937247809 28 Left 937247796 2:120504662-120504684 CCCACCTTAAGCTACCTGTTGAC No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data
937247795_937247809 29 Left 937247795 2:120504661-120504683 CCCCACCTTAAGCTACCTGTTGA No data
Right 937247809 2:120504713-120504735 GGTCTGGCGAGCAGACGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937247809 Original CRISPR GGTCTGGCGAGCAGACGGCA AGG Intergenic
No off target data available for this crispr