ID: 937248530

View in Genome Browser
Species Human (GRCh38)
Location 2:120509565-120509587
Sequence TCTGGTCTCACCAATCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937248530_937248540 21 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data
937248530_937248542 25 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248542 2:120509613-120509635 GGGACCAGGACTGGAAGGGGAGG No data
937248530_937248538 16 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248538 2:120509604-120509626 ATCATTCTGGGGACCAGGACTGG No data
937248530_937248539 20 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248539 2:120509608-120509630 TTCTGGGGACCAGGACTGGAAGG No data
937248530_937248541 22 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248541 2:120509610-120509632 CTGGGGACCAGGACTGGAAGGGG No data
937248530_937248534 4 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248534 2:120509592-120509614 AGTACCAAAAGCATCATTCTGGG No data
937248530_937248544 29 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248544 2:120509617-120509639 CCAGGACTGGAAGGGGAGGCTGG No data
937248530_937248533 3 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248533 2:120509591-120509613 AAGTACCAAAAGCATCATTCTGG No data
937248530_937248537 11 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248537 2:120509599-120509621 AAAGCATCATTCTGGGGACCAGG No data
937248530_937248535 5 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248535 2:120509593-120509615 GTACCAAAAGCATCATTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937248530 Original CRISPR TCTGGTCTCACCAATCCCCG TGG (reversed) Intergenic
No off target data available for this crispr