ID: 937248531

View in Genome Browser
Species Human (GRCh38)
Location 2:120509583-120509605
Sequence ATGCTTTTGGTACTTGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937248531_937248539 2 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248539 2:120509608-120509630 TTCTGGGGACCAGGACTGGAAGG No data
937248531_937248540 3 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data
937248531_937248537 -7 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248537 2:120509599-120509621 AAAGCATCATTCTGGGGACCAGG No data
937248531_937248547 27 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248547 2:120509633-120509655 AGGCTGGATAAACAGCTCAGGGG No data
937248531_937248541 4 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248541 2:120509610-120509632 CTGGGGACCAGGACTGGAAGGGG No data
937248531_937248548 30 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248548 2:120509636-120509658 CTGGATAAACAGCTCAGGGGAGG No data
937248531_937248546 26 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248546 2:120509632-120509654 GAGGCTGGATAAACAGCTCAGGG No data
937248531_937248544 11 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248544 2:120509617-120509639 CCAGGACTGGAAGGGGAGGCTGG No data
937248531_937248542 7 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248542 2:120509613-120509635 GGGACCAGGACTGGAAGGGGAGG No data
937248531_937248538 -2 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248538 2:120509604-120509626 ATCATTCTGGGGACCAGGACTGG No data
937248531_937248545 25 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248545 2:120509631-120509653 GGAGGCTGGATAAACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937248531 Original CRISPR ATGCTTTTGGTACTTGGATC TGG (reversed) Intergenic
No off target data available for this crispr