ID: 937248532

View in Genome Browser
Species Human (GRCh38)
Location 2:120509589-120509611
Sequence AGAATGATGCTTTTGGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937248532_937248544 5 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248544 2:120509617-120509639 CCAGGACTGGAAGGGGAGGCTGG No data
937248532_937248538 -8 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248538 2:120509604-120509626 ATCATTCTGGGGACCAGGACTGG No data
937248532_937248542 1 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248542 2:120509613-120509635 GGGACCAGGACTGGAAGGGGAGG No data
937248532_937248547 21 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248547 2:120509633-120509655 AGGCTGGATAAACAGCTCAGGGG No data
937248532_937248546 20 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248546 2:120509632-120509654 GAGGCTGGATAAACAGCTCAGGG No data
937248532_937248540 -3 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data
937248532_937248548 24 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248548 2:120509636-120509658 CTGGATAAACAGCTCAGGGGAGG No data
937248532_937248539 -4 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248539 2:120509608-120509630 TTCTGGGGACCAGGACTGGAAGG No data
937248532_937248545 19 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248545 2:120509631-120509653 GGAGGCTGGATAAACAGCTCAGG No data
937248532_937248541 -2 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248541 2:120509610-120509632 CTGGGGACCAGGACTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937248532 Original CRISPR AGAATGATGCTTTTGGTACT TGG (reversed) Intergenic
No off target data available for this crispr