ID: 937248540

View in Genome Browser
Species Human (GRCh38)
Location 2:120509609-120509631
Sequence TCTGGGGACCAGGACTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937248532_937248540 -3 Left 937248532 2:120509589-120509611 CCAAGTACCAAAAGCATCATTCT No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data
937248536_937248540 -10 Left 937248536 2:120509596-120509618 CCAAAAGCATCATTCTGGGGACC No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data
937248530_937248540 21 Left 937248530 2:120509565-120509587 CCACGGGGATTGGTGAGACCAGA No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data
937248531_937248540 3 Left 937248531 2:120509583-120509605 CCAGATCCAAGTACCAAAAGCAT No data
Right 937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937248540 Original CRISPR TCTGGGGACCAGGACTGGAA GGG Intergenic
No off target data available for this crispr