ID: 937249446

View in Genome Browser
Species Human (GRCh38)
Location 2:120514346-120514368
Sequence CTCACGGCCTGGCACACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937249438_937249446 13 Left 937249438 2:120514310-120514332 CCGGGCCTGATTCTTCTTGGTGC No data
Right 937249446 2:120514346-120514368 CTCACGGCCTGGCACACAGTAGG No data
937249439_937249446 8 Left 937249439 2:120514315-120514337 CCTGATTCTTCTTGGTGCTCCCT No data
Right 937249446 2:120514346-120514368 CTCACGGCCTGGCACACAGTAGG No data
937249436_937249446 26 Left 937249436 2:120514297-120514319 CCTGAAGGCAGGGCCGGGCCTGA No data
Right 937249446 2:120514346-120514368 CTCACGGCCTGGCACACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937249446 Original CRISPR CTCACGGCCTGGCACACAGT AGG Intergenic
No off target data available for this crispr