ID: 937251012

View in Genome Browser
Species Human (GRCh38)
Location 2:120523811-120523833
Sequence GAGTAGATCTTCCTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937251008_937251012 22 Left 937251008 2:120523766-120523788 CCTTACTTGGAGATGGGATCTTT No data
Right 937251012 2:120523811-120523833 GAGTAGATCTTCCTGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937251012 Original CRISPR GAGTAGATCTTCCTGGAGTA GGG Intergenic
No off target data available for this crispr