ID: 937252251

View in Genome Browser
Species Human (GRCh38)
Location 2:120532301-120532323
Sequence GACCGAGATGTGTCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937252251_937252252 4 Left 937252251 2:120532301-120532323 CCAAAGGGAGACACATCTCGGTC No data
Right 937252252 2:120532328-120532350 GAGTGTTGTGTTGCCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937252251 Original CRISPR GACCGAGATGTGTCTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr