ID: 937252539

View in Genome Browser
Species Human (GRCh38)
Location 2:120533798-120533820
Sequence TTCCCACAGCTGCCGGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937252527_937252539 24 Left 937252527 2:120533751-120533773 CCCGGCGTGGACAGGCTGGGGCC No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data
937252532_937252539 3 Left 937252532 2:120533772-120533794 CCTGGCCAGGCCAAGCAGGCACA No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data
937252526_937252539 25 Left 937252526 2:120533750-120533772 CCCCGGCGTGGACAGGCTGGGGC No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data
937252533_937252539 -2 Left 937252533 2:120533777-120533799 CCAGGCCAAGCAGGCACAGCCTT No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data
937252528_937252539 23 Left 937252528 2:120533752-120533774 CCGGCGTGGACAGGCTGGGGCCT No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data
937252524_937252539 26 Left 937252524 2:120533749-120533771 CCCCCGGCGTGGACAGGCTGGGG No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data
937252534_937252539 -7 Left 937252534 2:120533782-120533804 CCAAGCAGGCACAGCCTTCCCAC No data
Right 937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937252539 Original CRISPR TTCCCACAGCTGCCGGGGAC CGG Intergenic
No off target data available for this crispr