ID: 937253047

View in Genome Browser
Species Human (GRCh38)
Location 2:120536119-120536141
Sequence CCACCGTGCAGCCCCCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937253044_937253047 2 Left 937253044 2:120536094-120536116 CCTGGGATCAGGGTGCATTGAAT No data
Right 937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG No data
937253043_937253047 8 Left 937253043 2:120536088-120536110 CCTTTGCCTGGGATCAGGGTGCA No data
Right 937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG No data
937253040_937253047 12 Left 937253040 2:120536084-120536106 CCACCCTTTGCCTGGGATCAGGG No data
Right 937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG No data
937253042_937253047 9 Left 937253042 2:120536087-120536109 CCCTTTGCCTGGGATCAGGGTGC No data
Right 937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG No data
937253036_937253047 22 Left 937253036 2:120536074-120536096 CCAGACACAGCCACCCTTTGCCT No data
Right 937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937253047 Original CRISPR CCACCGTGCAGCCCCCTTAA AGG Intergenic
No off target data available for this crispr