ID: 937254612

View in Genome Browser
Species Human (GRCh38)
Location 2:120546368-120546390
Sequence CAGTGCAGACATCTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937254612_937254626 19 Left 937254612 2:120546368-120546390 CCTGGCTCCAGATGTCTGCACTG No data
Right 937254626 2:120546410-120546432 ATGGGGAAACTGACAAGCTGTGG No data
937254612_937254621 -4 Left 937254612 2:120546368-120546390 CCTGGCTCCAGATGTCTGCACTG No data
Right 937254621 2:120546387-120546409 ACTGGGGGATTGGGGCTGCCTGG No data
937254612_937254624 2 Left 937254612 2:120546368-120546390 CCTGGCTCCAGATGTCTGCACTG No data
Right 937254624 2:120546393-120546415 GGATTGGGGCTGCCTGGATGGGG No data
937254612_937254623 1 Left 937254612 2:120546368-120546390 CCTGGCTCCAGATGTCTGCACTG No data
Right 937254623 2:120546392-120546414 GGGATTGGGGCTGCCTGGATGGG No data
937254612_937254622 0 Left 937254612 2:120546368-120546390 CCTGGCTCCAGATGTCTGCACTG No data
Right 937254622 2:120546391-120546413 GGGGATTGGGGCTGCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937254612 Original CRISPR CAGTGCAGACATCTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr