ID: 937255410

View in Genome Browser
Species Human (GRCh38)
Location 2:120552051-120552073
Sequence ATGGTTAAGTAGCTCCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937255407_937255410 6 Left 937255407 2:120552022-120552044 CCTTAATAGCTAACTGCAGAGAG No data
Right 937255410 2:120552051-120552073 ATGGTTAAGTAGCTCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937255410 Original CRISPR ATGGTTAAGTAGCTCCTCCA AGG Intergenic
No off target data available for this crispr