ID: 937255967

View in Genome Browser
Species Human (GRCh38)
Location 2:120555774-120555796
Sequence CTGTGAGTCTCCGACGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937255963_937255967 11 Left 937255963 2:120555740-120555762 CCAAGCTCTGGGAGGCACGGTCC No data
Right 937255967 2:120555774-120555796 CTGTGAGTCTCCGACGCAGGTGG No data
937255964_937255967 -10 Left 937255964 2:120555761-120555783 CCTAGTTCAGAGCCTGTGAGTCT No data
Right 937255967 2:120555774-120555796 CTGTGAGTCTCCGACGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937255967 Original CRISPR CTGTGAGTCTCCGACGCAGG TGG Intergenic
No off target data available for this crispr