ID: 937256687

View in Genome Browser
Species Human (GRCh38)
Location 2:120560858-120560880
Sequence TCTGGAAGGCAAAGGCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937256677_937256687 16 Left 937256677 2:120560819-120560841 CCCTAGGGATGCGTCACCACCTC No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256679_937256687 0 Left 937256679 2:120560835-120560857 CCACCTCTCCCATCACTGCTCAA No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256674_937256687 21 Left 937256674 2:120560814-120560836 CCTCCCCCTAGGGATGCGTCACC No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256680_937256687 -3 Left 937256680 2:120560838-120560860 CCTCTCCCATCACTGCTCAATCT No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256678_937256687 15 Left 937256678 2:120560820-120560842 CCTAGGGATGCGTCACCACCTCT No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256673_937256687 27 Left 937256673 2:120560808-120560830 CCATGACCTCCCCCTAGGGATGC No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256675_937256687 18 Left 937256675 2:120560817-120560839 CCCCCTAGGGATGCGTCACCACC No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256683_937256687 -9 Left 937256683 2:120560844-120560866 CCATCACTGCTCAATCTGGAAGG No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256676_937256687 17 Left 937256676 2:120560818-120560840 CCCCTAGGGATGCGTCACCACCT No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data
937256682_937256687 -8 Left 937256682 2:120560843-120560865 CCCATCACTGCTCAATCTGGAAG No data
Right 937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937256687 Original CRISPR TCTGGAAGGCAAAGGCTAGA GGG Intergenic
No off target data available for this crispr