ID: 937260497

View in Genome Browser
Species Human (GRCh38)
Location 2:120583340-120583362
Sequence AACTGCCTTCAGAACTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937260497_937260501 2 Left 937260497 2:120583340-120583362 CCCTCAGAGTTCTGAAGGCAGTT No data
Right 937260501 2:120583365-120583387 CTATTGGCATGTGGTGTTCTAGG No data
937260497_937260500 -7 Left 937260497 2:120583340-120583362 CCCTCAGAGTTCTGAAGGCAGTT No data
Right 937260500 2:120583356-120583378 GGCAGTTCTCTATTGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937260497 Original CRISPR AACTGCCTTCAGAACTCTGA GGG (reversed) Intergenic
No off target data available for this crispr