ID: 937261970

View in Genome Browser
Species Human (GRCh38)
Location 2:120592257-120592279
Sequence ACAACCTGCTGCAAAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937261970_937261976 21 Left 937261970 2:120592257-120592279 CCAGTACCTTTGCAGCAGGTTGT No data
Right 937261976 2:120592301-120592323 CCAACGGAGTCCGAATGAGCAGG No data
937261970_937261973 5 Left 937261970 2:120592257-120592279 CCAGTACCTTTGCAGCAGGTTGT No data
Right 937261973 2:120592285-120592307 CGTGATCAAGTTCCAGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937261970 Original CRISPR ACAACCTGCTGCAAAGGTAC TGG (reversed) Intergenic
No off target data available for this crispr