ID: 937263983

View in Genome Browser
Species Human (GRCh38)
Location 2:120604611-120604633
Sequence GCATCTACTCAGGTTTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937263983_937263987 -9 Left 937263983 2:120604611-120604633 CCTCACCAAACCTGAGTAGATGC No data
Right 937263987 2:120604625-120604647 AGTAGATGCTGGTGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937263983 Original CRISPR GCATCTACTCAGGTTTGGTG AGG (reversed) Intergenic
No off target data available for this crispr