ID: 937264264

View in Genome Browser
Species Human (GRCh38)
Location 2:120606253-120606275
Sequence GTGATGAACCTGTCTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937264258_937264264 0 Left 937264258 2:120606230-120606252 CCCTGCTGCACTTCCTGTGCCTG No data
Right 937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG No data
937264259_937264264 -1 Left 937264259 2:120606231-120606253 CCTGCTGCACTTCCTGTGCCTGG No data
Right 937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937264264 Original CRISPR GTGATGAACCTGTCTGTGGA TGG Intergenic
No off target data available for this crispr