ID: 937264484

View in Genome Browser
Species Human (GRCh38)
Location 2:120607292-120607314
Sequence CAGGGCATAGAGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937264475_937264484 2 Left 937264475 2:120607267-120607289 CCTGAGCTGATCCCCAAGGGGCA No data
Right 937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG No data
937264469_937264484 16 Left 937264469 2:120607253-120607275 CCCCAGGATGGATGCCTGAGCTG No data
Right 937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG No data
937264471_937264484 14 Left 937264471 2:120607255-120607277 CCAGGATGGATGCCTGAGCTGAT No data
Right 937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG No data
937264479_937264484 -10 Left 937264479 2:120607279-120607301 CCCAAGGGGCAGCCAGGGCATAG No data
Right 937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG No data
937264470_937264484 15 Left 937264470 2:120607254-120607276 CCCAGGATGGATGCCTGAGCTGA No data
Right 937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG No data
937264478_937264484 -9 Left 937264478 2:120607278-120607300 CCCCAAGGGGCAGCCAGGGCATA No data
Right 937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937264484 Original CRISPR CAGGGCATAGAGCAGGAGGA TGG Intergenic
No off target data available for this crispr