ID: 937265688

View in Genome Browser
Species Human (GRCh38)
Location 2:120613497-120613519
Sequence GTGCACGCACGCGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937265688_937265696 16 Left 937265688 2:120613497-120613519 CCCCAGCACACGCGTGCGTGCAC No data
Right 937265696 2:120613536-120613558 CTTGTCTTCTCTTCTGAGCATGG No data
937265688_937265697 30 Left 937265688 2:120613497-120613519 CCCCAGCACACGCGTGCGTGCAC No data
Right 937265697 2:120613550-120613572 TGAGCATGGCCACTCTAGTTTGG No data
937265688_937265692 -7 Left 937265688 2:120613497-120613519 CCCCAGCACACGCGTGCGTGCAC No data
Right 937265692 2:120613513-120613535 CGTGCACACACACGGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937265688 Original CRISPR GTGCACGCACGCGTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr