ID: 937268638

View in Genome Browser
Species Human (GRCh38)
Location 2:120633139-120633161
Sequence CAGAAAAAGGAGGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937268626_937268638 -5 Left 937268626 2:120633121-120633143 CCCTGCCCAGCTGACATCCAGAA No data
Right 937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG No data
937268628_937268638 -10 Left 937268628 2:120633126-120633148 CCCAGCTGACATCCAGAAAAAGG No data
Right 937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG No data
937268624_937268638 -1 Left 937268624 2:120633117-120633139 CCACCCCTGCCCAGCTGACATCC No data
Right 937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG No data
937268627_937268638 -6 Left 937268627 2:120633122-120633144 CCTGCCCAGCTGACATCCAGAAA No data
Right 937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG No data
937268625_937268638 -4 Left 937268625 2:120633120-120633142 CCCCTGCCCAGCTGACATCCAGA No data
Right 937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG No data
937268623_937268638 0 Left 937268623 2:120633116-120633138 CCCACCCCTGCCCAGCTGACATC No data
Right 937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937268638 Original CRISPR CAGAAAAAGGAGGGGGAGGA GGG Intergenic
No off target data available for this crispr