ID: 937268969

View in Genome Browser
Species Human (GRCh38)
Location 2:120635113-120635135
Sequence TTGTATGTGCATTAATAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937268969_937268971 22 Left 937268969 2:120635113-120635135 CCAACCTATTAATGCACATACAA No data
Right 937268971 2:120635158-120635180 AGTGATGTAATAAACACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937268969 Original CRISPR TTGTATGTGCATTAATAGGT TGG (reversed) Intergenic
No off target data available for this crispr