ID: 937271596

View in Genome Browser
Species Human (GRCh38)
Location 2:120656446-120656468
Sequence CTCCCTGAGCAGAGGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937271596_937271606 12 Left 937271596 2:120656446-120656468 CCCAGGGCCCTCTGCTCAGGGAG No data
Right 937271606 2:120656481-120656503 AGGGCCCTATCCCAAGGCCCGGG No data
937271596_937271605 11 Left 937271596 2:120656446-120656468 CCCAGGGCCCTCTGCTCAGGGAG No data
Right 937271605 2:120656480-120656502 AAGGGCCCTATCCCAAGGCCCGG No data
937271596_937271603 -7 Left 937271596 2:120656446-120656468 CCCAGGGCCCTCTGCTCAGGGAG No data
Right 937271603 2:120656462-120656484 CAGGGAGGAGAATCAGGAAAGGG No data
937271596_937271602 -8 Left 937271596 2:120656446-120656468 CCCAGGGCCCTCTGCTCAGGGAG No data
Right 937271602 2:120656461-120656483 TCAGGGAGGAGAATCAGGAAAGG No data
937271596_937271604 6 Left 937271596 2:120656446-120656468 CCCAGGGCCCTCTGCTCAGGGAG No data
Right 937271604 2:120656475-120656497 CAGGAAAGGGCCCTATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937271596 Original CRISPR CTCCCTGAGCAGAGGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr