ID: 937271747

View in Genome Browser
Species Human (GRCh38)
Location 2:120657232-120657254
Sequence GCCTGAGAGCCCACCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937271747_937271754 2 Left 937271747 2:120657232-120657254 CCCCCAAAGGTGGGCTCTCAGGC No data
Right 937271754 2:120657257-120657279 CATGAGGCATCAGTGGATGGTGG No data
937271747_937271756 12 Left 937271747 2:120657232-120657254 CCCCCAAAGGTGGGCTCTCAGGC No data
Right 937271756 2:120657267-120657289 CAGTGGATGGTGGTGACAGAGGG No data
937271747_937271755 11 Left 937271747 2:120657232-120657254 CCCCCAAAGGTGGGCTCTCAGGC No data
Right 937271755 2:120657266-120657288 TCAGTGGATGGTGGTGACAGAGG No data
937271747_937271753 -1 Left 937271747 2:120657232-120657254 CCCCCAAAGGTGGGCTCTCAGGC No data
Right 937271753 2:120657254-120657276 CATCATGAGGCATCAGTGGATGG No data
937271747_937271752 -5 Left 937271747 2:120657232-120657254 CCCCCAAAGGTGGGCTCTCAGGC No data
Right 937271752 2:120657250-120657272 CAGGCATCATGAGGCATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937271747 Original CRISPR GCCTGAGAGCCCACCTTTGG GGG (reversed) Intergenic
No off target data available for this crispr