ID: 937271874

View in Genome Browser
Species Human (GRCh38)
Location 2:120658108-120658130
Sequence CAAGTTGAGCCCATCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937271874_937271875 -10 Left 937271874 2:120658108-120658130 CCAATATGGATGGGCTCAACTTG No data
Right 937271875 2:120658121-120658143 GCTCAACTTGTAATTAGCTTTGG No data
937271874_937271876 -1 Left 937271874 2:120658108-120658130 CCAATATGGATGGGCTCAACTTG No data
Right 937271876 2:120658130-120658152 GTAATTAGCTTTGGACCAGCAGG No data
937271874_937271877 8 Left 937271874 2:120658108-120658130 CCAATATGGATGGGCTCAACTTG No data
Right 937271877 2:120658139-120658161 TTTGGACCAGCAGGATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937271874 Original CRISPR CAAGTTGAGCCCATCCATAT TGG (reversed) Intergenic
No off target data available for this crispr