ID: 937275229

View in Genome Browser
Species Human (GRCh38)
Location 2:120679748-120679770
Sequence TAGGGTGGCTGAGAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937275221_937275229 6 Left 937275221 2:120679719-120679741 CCATCACGTGCTCTCCTTGCCCA No data
Right 937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG No data
937275224_937275229 -8 Left 937275224 2:120679733-120679755 CCTTGCCCATGCTCCTAGGGTGG No data
Right 937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG No data
937275220_937275229 25 Left 937275220 2:120679700-120679722 CCATCGAGGGGCACGGGAGCCAT No data
Right 937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937275229 Original CRISPR TAGGGTGGCTGAGAAGCTGC AGG Intergenic
No off target data available for this crispr