ID: 937278666

View in Genome Browser
Species Human (GRCh38)
Location 2:120702665-120702687
Sequence TACCCACATCACCCCGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937278666_937278671 0 Left 937278666 2:120702665-120702687 CCAGTAACGGGGTGATGTGGGTA No data
Right 937278671 2:120702688-120702710 GGGGTGTGAGTGGCACCCCCAGG No data
937278666_937278670 -10 Left 937278666 2:120702665-120702687 CCAGTAACGGGGTGATGTGGGTA No data
Right 937278670 2:120702678-120702700 GATGTGGGTAGGGGTGTGAGTGG No data
937278666_937278672 6 Left 937278666 2:120702665-120702687 CCAGTAACGGGGTGATGTGGGTA No data
Right 937278672 2:120702694-120702716 TGAGTGGCACCCCCAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937278666 Original CRISPR TACCCACATCACCCCGTTAC TGG (reversed) Intergenic
No off target data available for this crispr