ID: 937278666 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:120702665-120702687 |
| Sequence | TACCCACATCACCCCGTTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937278666_937278671 | 0 | Left | 937278666 | 2:120702665-120702687 | CCAGTAACGGGGTGATGTGGGTA | No data | ||
| Right | 937278671 | 2:120702688-120702710 | GGGGTGTGAGTGGCACCCCCAGG | No data | ||||
| 937278666_937278670 | -10 | Left | 937278666 | 2:120702665-120702687 | CCAGTAACGGGGTGATGTGGGTA | No data | ||
| Right | 937278670 | 2:120702678-120702700 | GATGTGGGTAGGGGTGTGAGTGG | No data | ||||
| 937278666_937278672 | 6 | Left | 937278666 | 2:120702665-120702687 | CCAGTAACGGGGTGATGTGGGTA | No data | ||
| Right | 937278672 | 2:120702694-120702716 | TGAGTGGCACCCCCAGGCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937278666 | Original CRISPR | TACCCACATCACCCCGTTAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||