ID: 937278699

View in Genome Browser
Species Human (GRCh38)
Location 2:120702841-120702863
Sequence AGGAAGGAGCAGAATGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937278699_937278711 29 Left 937278699 2:120702841-120702863 CCGACCTCATTCTGCTCCTTCCT No data
Right 937278711 2:120702893-120702915 ATTAAAGCAGAGGCGGGGTGAGG No data
937278699_937278708 22 Left 937278699 2:120702841-120702863 CCGACCTCATTCTGCTCCTTCCT No data
Right 937278708 2:120702886-120702908 ATCATATATTAAAGCAGAGGCGG No data
937278699_937278710 24 Left 937278699 2:120702841-120702863 CCGACCTCATTCTGCTCCTTCCT No data
Right 937278710 2:120702888-120702910 CATATATTAAAGCAGAGGCGGGG No data
937278699_937278707 19 Left 937278699 2:120702841-120702863 CCGACCTCATTCTGCTCCTTCCT No data
Right 937278707 2:120702883-120702905 TGCATCATATATTAAAGCAGAGG No data
937278699_937278702 -10 Left 937278699 2:120702841-120702863 CCGACCTCATTCTGCTCCTTCCT No data
Right 937278702 2:120702854-120702876 GCTCCTTCCTCTGCCGTGGCTGG No data
937278699_937278709 23 Left 937278699 2:120702841-120702863 CCGACCTCATTCTGCTCCTTCCT No data
Right 937278709 2:120702887-120702909 TCATATATTAAAGCAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937278699 Original CRISPR AGGAAGGAGCAGAATGAGGT CGG (reversed) Intergenic
No off target data available for this crispr