ID: 937280256

View in Genome Browser
Species Human (GRCh38)
Location 2:120712793-120712815
Sequence CTGTGCCAACACCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937280249_937280256 9 Left 937280249 2:120712761-120712783 CCCTGGATATCCAGCCAGGACAG No data
Right 937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG No data
937280252_937280256 -5 Left 937280252 2:120712775-120712797 CCAGGACAGAGCCAACACCTGTG No data
Right 937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG No data
937280250_937280256 8 Left 937280250 2:120712762-120712784 CCTGGATATCCAGCCAGGACAGA No data
Right 937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG No data
937280251_937280256 -1 Left 937280251 2:120712771-120712793 CCAGCCAGGACAGAGCCAACACC No data
Right 937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937280256 Original CRISPR CTGTGCCAACACCTGGAGCC AGG Intergenic
No off target data available for this crispr