ID: 937280598

View in Genome Browser
Species Human (GRCh38)
Location 2:120714876-120714898
Sequence CTTTCAACATTTAAAGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937280598_937280605 19 Left 937280598 2:120714876-120714898 CCACCTACTTTAAATGTTGAAAG No data
Right 937280605 2:120714918-120714940 CCCAAAGTTACATACCCACCTGG No data
937280598_937280607 28 Left 937280598 2:120714876-120714898 CCACCTACTTTAAATGTTGAAAG No data
Right 937280607 2:120714927-120714949 ACATACCCACCTGGAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937280598 Original CRISPR CTTTCAACATTTAAAGTAGG TGG (reversed) Intergenic
No off target data available for this crispr