ID: 937283208

View in Genome Browser
Species Human (GRCh38)
Location 2:120734905-120734927
Sequence CACCCGAAGAGGGTCTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 77}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937283208_937283221 0 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283221 2:120734928-120734950 AGGCCCAGGGGCCCTGGAGAGGG 0: 1
1: 0
2: 6
3: 56
4: 647
937283208_937283223 3 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283223 2:120734931-120734953 CCCAGGGGCCCTGGAGAGGGTGG 0: 1
1: 0
2: 13
3: 106
4: 793
937283208_937283233 21 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283233 2:120734949-120734971 GGTGGCAGGCCCGGGGGTGTGGG 0: 1
1: 0
2: 6
3: 58
4: 439
937283208_937283231 15 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283231 2:120734943-120734965 GGAGAGGGTGGCAGGCCCGGGGG 0: 1
1: 0
2: 5
3: 98
4: 1441
937283208_937283235 25 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283235 2:120734953-120734975 GCAGGCCCGGGGGTGTGGGGAGG 0: 1
1: 1
2: 10
3: 107
4: 933
937283208_937283219 -6 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283219 2:120734922-120734944 CGGGTGAGGCCCAGGGGCCCTGG 0: 1
1: 2
2: 2
3: 66
4: 481
937283208_937283232 20 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283232 2:120734948-120734970 GGGTGGCAGGCCCGGGGGTGTGG 0: 1
1: 0
2: 2
3: 112
4: 937
937283208_937283234 22 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283234 2:120734950-120734972 GTGGCAGGCCCGGGGGTGTGGGG 0: 1
1: 1
2: 5
3: 39
4: 519
937283208_937283229 13 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283229 2:120734941-120734963 CTGGAGAGGGTGGCAGGCCCGGG 0: 1
1: 2
2: 5
3: 92
4: 1052
937283208_937283230 14 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283230 2:120734942-120734964 TGGAGAGGGTGGCAGGCCCGGGG 0: 1
1: 0
2: 4
3: 55
4: 440
937283208_937283228 12 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283228 2:120734940-120734962 CCTGGAGAGGGTGGCAGGCCCGG 0: 1
1: 1
2: 8
3: 300
4: 2157
937283208_937283225 7 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283225 2:120734935-120734957 GGGGCCCTGGAGAGGGTGGCAGG 0: 1
1: 1
2: 5
3: 162
4: 1069
937283208_937283220 -1 Left 937283208 2:120734905-120734927 CCCCCCAAGACCCTCTTCGGGTG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 937283220 2:120734927-120734949 GAGGCCCAGGGGCCCTGGAGAGG 0: 1
1: 0
2: 5
3: 85
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937283208 Original CRISPR CACCCGAAGAGGGTCTTGGG GGG (reversed) Intergenic
901717536 1:11168546-11168568 CCCCTGAAGAGGGTCTAGGGAGG - Intronic
901986243 1:13077460-13077482 CACCCCAAGAGGATCTTGTTCGG + Exonic
901995569 1:13149307-13149329 CACCCCAAGAGGATCTTGTTCGG - Intergenic
904834185 1:33324349-33324371 CACCTGCAGAGGGTGTAGGGGGG + Exonic
915622679 1:157095500-157095522 CACTCCAAGTGGGGCTTGGGAGG + Intronic
916472542 1:165138159-165138181 CAGCAGAACAGGGGCTTGGGTGG + Intergenic
919191731 1:194230174-194230196 CACCAGAGGAGGGTCTGGAGAGG + Intergenic
921449453 1:215287675-215287697 TACCCTAAGAGGGTTGTGGGAGG + Intergenic
1063086451 10:2822528-2822550 AGCCCCATGAGGGTCTTGGGTGG + Intergenic
1069736735 10:70661558-70661580 CTCCCGCACAGGGTCTTTGGAGG + Intergenic
1076827149 10:132974790-132974812 CCCTCGAAGAGGGGCTGGGGTGG - Intergenic
1078555225 11:12319827-12319849 CAGCCAAAGAGGGCCTTGGCTGG + Intronic
1083632740 11:64104145-64104167 CAAACCCAGAGGGTCTTGGGCGG + Exonic
1084701410 11:70788609-70788631 CACCCAATGGGGGTCTTGGGAGG + Intronic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1089561491 11:119345546-119345568 CACACGCAGTGGGTGTTGGGGGG + Exonic
1092289826 12:7153149-7153171 CAACCGCAGAGGCTTTTGGGAGG + Intronic
1097450531 12:59732978-59733000 CACCCAAAAGGGCTCTTGGGAGG + Intronic
1100377535 12:94031255-94031277 CACCCCAGTATGGTCTTGGGAGG + Intergenic
1102347782 12:112170509-112170531 GACCGGAAGAGAGTCTTGGGGGG - Intronic
1102945114 12:116979946-116979968 CACCTGGAGAGGGCCTGGGGAGG - Intronic
1104119865 12:125788991-125789013 CTCCAGAGGAGGGTCTTGGGAGG + Intergenic
1105532601 13:21233269-21233291 CTCCTGGACAGGGTCTTGGGGGG - Intergenic
1109566653 13:64125960-64125982 CACTGAAACAGGGTCTTGGGAGG + Intergenic
1117145125 14:52829788-52829810 CAGCCTAAGAGGTTCTGGGGAGG + Intergenic
1118925408 14:70187097-70187119 CACCCGAAGGGGGTGGGGGGAGG - Intronic
1120606920 14:86591062-86591084 TACCCAAAGAGGGTCTGGAGTGG - Intergenic
1121519340 14:94575312-94575334 CACCGGGTGAGGGACTTGGGTGG + Intronic
1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG + Intronic
1131461766 15:92622593-92622615 CCCCCGAGGAGGGGCTTGGGGGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG + Intronic
1132936201 16:2482588-2482610 CACCAGGAGAGGGTTTCGGGTGG + Intronic
1133663092 16:7937851-7937873 CACCAGAAGATGGACTTGGGTGG + Intergenic
1133669611 16:8005593-8005615 CATCCGATGATGGTCTTGGCTGG - Intergenic
1136135675 16:28255566-28255588 CATCAGAAGAGGGTCAGGGGTGG + Intergenic
1137660882 16:50205140-50205162 CATCCGAAGAGGGACTGGGGGGG - Intronic
1138432706 16:56979281-56979303 CACCCCAATAGGGTGTGGGGTGG + Intronic
1141684407 16:85562062-85562084 CGCCCAGAGTGGGTCTTGGGTGG - Intergenic
1144490109 17:15700992-15701014 CCCGGGAAGAGGGTCCTGGGAGG + Intronic
1144910854 17:18680967-18680989 CCCGGGAAGAGGGTCCTGGGAGG - Intronic
1145816982 17:27802343-27802365 CCCCCTCAGAGGCTCTTGGGTGG - Intronic
1147191104 17:38738674-38738696 CATCCAGAGAGGGTCCTGGGTGG + Intronic
1150427150 17:65086027-65086049 CTGCCGTGGAGGGTCTTGGGGGG + Intergenic
1152631260 17:81411622-81411644 CACCCGAAGAGGGTGTGGGGTGG + Intronic
1156285847 18:35695252-35695274 CACAAGTAGAGGGTGTTGGGTGG + Intronic
1157952973 18:52061018-52061040 CATCTGAAGAGGGTCTCAGGGGG - Intergenic
1158396369 18:57081216-57081238 CCCCTGAAGAGGGTCTTTGATGG - Intergenic
1163548018 19:17950777-17950799 CCCCCGGGGAGGGTGTTGGGTGG + Intergenic
1167270446 19:48502892-48502914 CAACTGGTGAGGGTCTTGGGGGG - Exonic
927034830 2:19163871-19163893 CACGCAAACAGGGTCTGGGGTGG - Intergenic
927503046 2:23595162-23595184 CACCCGCAGAGGGCCTGGGAAGG + Intronic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
941450352 2:165653179-165653201 CATCAGAAGAGAGACTTGGGTGG + Intronic
947817589 2:233048530-233048552 CCCCAGAAGAGTGCCTTGGGTGG - Intergenic
1173552130 20:43939842-43939864 CACCCCAAGAGTGTCTTATGGGG + Intronic
1174898641 20:54475885-54475907 CACCCGAAGTGGCTCTGGGGAGG - Exonic
1175804648 20:61820749-61820771 AAGCTGATGAGGGTCTTGGGAGG - Intronic
1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG + Intergenic
1179689052 21:43070093-43070115 CAGCCCAAGAGGCTCCTGGGAGG + Intronic
1182892008 22:33826962-33826984 CACCTGAAAAGGGTCTGGGATGG + Intronic
1183489228 22:38107964-38107986 CAGCGGAAGAGGGTGGTGGGTGG - Intronic
1183975277 22:41508443-41508465 CTCCCGGAGAGGGTCCTTGGAGG - Intronic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
969470453 4:7384639-7384661 CTCCCAAGAAGGGTCTTGGGTGG - Intronic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
970185264 4:13445646-13445668 CAGGCGAACAGGGTCTTGAGTGG - Intronic
970383093 4:15527904-15527926 CACCAGAAGTGGGTGTTAGGTGG + Intronic
971227575 4:24769167-24769189 CACCAGAAGAGGATCATTGGTGG + Intergenic
973257469 4:48127895-48127917 CACCCCCAGAGGTTCCTGGGTGG + Intronic
998404990 5:141869245-141869267 CTCCCAATGAGGGTGTTGGGTGG + Exonic
1003389666 6:5702852-5702874 CTCCTGGACAGGGTCTTGGGGGG + Intronic
1017633716 6:156423453-156423475 CACCCGAGCAGAGTCTCGGGGGG - Intergenic
1017747939 6:157463591-157463613 CACCTGAAGAAGGTCTTGCCAGG + Intronic
1021502207 7:21344574-21344596 CAGGCAAAGAGGGTCTGGGGTGG - Intergenic
1024372820 7:48606508-48606530 CACCCAAACAGGGTCTGGAGCGG - Intronic
1026889628 7:73974358-73974380 CAACCGAAGCGGTTCCTGGGAGG + Intergenic
1029073096 7:97915914-97915936 CACACGATGAGGCTCTTCGGTGG + Intergenic
1042985142 8:74575017-74575039 CACCTTAAGAGGTTTTTGGGAGG + Intergenic
1044015936 8:87048885-87048907 CACCCAAAGATTGTTTTGGGGGG - Intronic
1044847921 8:96399794-96399816 CACCTCAAGGGGTTCTTGGGAGG - Intergenic
1045892621 8:107175151-107175173 CACCCTGAGAGGGGCTTGGGTGG - Intergenic
1048534371 8:135278673-135278695 CACCCCAAGATGGTCTGGGAGGG + Intergenic
1049395423 8:142398014-142398036 CAGCCTGTGAGGGTCTTGGGAGG - Intronic
1052379965 9:27759450-27759472 CACTTGAAGTGGGTCTAGGGTGG - Intergenic
1055116574 9:72611741-72611763 AGCCAGAAGAAGGTCTTGGGTGG + Intronic
1056848429 9:90059895-90059917 CACTAGGAGAGGGTCTCGGGTGG + Intergenic
1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG + Intronic
1185925089 X:4136985-4137007 AACCCGAAGTGTGTCTTGAGTGG + Intergenic
1193349544 X:80444728-80444750 CACACGAAGAGGCACTTGAGTGG - Exonic