ID: 937283635

View in Genome Browser
Species Human (GRCh38)
Location 2:120736601-120736623
Sequence CGGCCTCCGCGCGCCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937283628_937283635 4 Left 937283628 2:120736574-120736596 CCACTCTTCTCGGGGTGCACAGC No data
Right 937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG No data
937283623_937283635 22 Left 937283623 2:120736556-120736578 CCTACCTGGGGGAGAGCACCACT No data
Right 937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG No data
937283621_937283635 28 Left 937283621 2:120736550-120736572 CCTCTCCCTACCTGGGGGAGAGC No data
Right 937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG No data
937283620_937283635 29 Left 937283620 2:120736549-120736571 CCCTCTCCCTACCTGGGGGAGAG No data
Right 937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG No data
937283624_937283635 18 Left 937283624 2:120736560-120736582 CCTGGGGGAGAGCACCACTCTTC No data
Right 937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG No data
937283622_937283635 23 Left 937283622 2:120736555-120736577 CCCTACCTGGGGGAGAGCACCAC No data
Right 937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937283635 Original CRISPR CGGCCTCCGCGCGCCGGCGG GGG Intronic
No off target data available for this crispr