ID: 937284055

View in Genome Browser
Species Human (GRCh38)
Location 2:120738805-120738827
Sequence AGCCCGGAAGTCTCTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937284055_937284060 10 Left 937284055 2:120738805-120738827 CCTTCAGCAGAGACTTCCGGGCT No data
Right 937284060 2:120738838-120738860 TCATTCTGCTCTGGCCTTGAAGG No data
937284055_937284057 1 Left 937284055 2:120738805-120738827 CCTTCAGCAGAGACTTCCGGGCT No data
Right 937284057 2:120738829-120738851 CTCCCAAACTCATTCTGCTCTGG No data
937284055_937284062 12 Left 937284055 2:120738805-120738827 CCTTCAGCAGAGACTTCCGGGCT No data
Right 937284062 2:120738840-120738862 ATTCTGCTCTGGCCTTGAAGGGG No data
937284055_937284064 27 Left 937284055 2:120738805-120738827 CCTTCAGCAGAGACTTCCGGGCT No data
Right 937284064 2:120738855-120738877 TGAAGGGGACTCTTGACTCGTGG No data
937284055_937284061 11 Left 937284055 2:120738805-120738827 CCTTCAGCAGAGACTTCCGGGCT No data
Right 937284061 2:120738839-120738861 CATTCTGCTCTGGCCTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937284055 Original CRISPR AGCCCGGAAGTCTCTGCTGA AGG (reversed) Intronic
No off target data available for this crispr