ID: 937285023

View in Genome Browser
Species Human (GRCh38)
Location 2:120745274-120745296
Sequence AGCGCCATCAGGATGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937285016_937285023 17 Left 937285016 2:120745234-120745256 CCCTGGGATGCCTCCTTTCTTTT No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data
937285014_937285023 26 Left 937285014 2:120745225-120745247 CCCAAGTGTCCCTGGGATGCCTC No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data
937285018_937285023 7 Left 937285018 2:120745244-120745266 CCTCCTTTCTTTTTCCATGTAAG No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data
937285021_937285023 -7 Left 937285021 2:120745258-120745280 CCATGTAAGGAACTGCAGCGCCA No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data
937285015_937285023 25 Left 937285015 2:120745226-120745248 CCAAGTGTCCCTGGGATGCCTCC No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data
937285017_937285023 16 Left 937285017 2:120745235-120745257 CCTGGGATGCCTCCTTTCTTTTT No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data
937285020_937285023 4 Left 937285020 2:120745247-120745269 CCTTTCTTTTTCCATGTAAGGAA No data
Right 937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937285023 Original CRISPR AGCGCCATCAGGATGCTTTG TGG Intronic
No off target data available for this crispr