ID: 937288842

View in Genome Browser
Species Human (GRCh38)
Location 2:120769800-120769822
Sequence TTCCCAACACACTCCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937288842_937288844 -1 Left 937288842 2:120769800-120769822 CCTGTTTGGGAGTGTGTTGGGAA No data
Right 937288844 2:120769822-120769844 ATGTGTGTCTGCTTGTGCATGGG No data
937288842_937288847 22 Left 937288842 2:120769800-120769822 CCTGTTTGGGAGTGTGTTGGGAA No data
Right 937288847 2:120769845-120769867 CTTTAAGTGTGTGGAAGTTTGGG No data
937288842_937288846 21 Left 937288842 2:120769800-120769822 CCTGTTTGGGAGTGTGTTGGGAA No data
Right 937288846 2:120769844-120769866 GCTTTAAGTGTGTGGAAGTTTGG No data
937288842_937288845 13 Left 937288842 2:120769800-120769822 CCTGTTTGGGAGTGTGTTGGGAA No data
Right 937288845 2:120769836-120769858 GTGCATGGGCTTTAAGTGTGTGG No data
937288842_937288843 -2 Left 937288842 2:120769800-120769822 CCTGTTTGGGAGTGTGTTGGGAA No data
Right 937288843 2:120769821-120769843 AATGTGTGTCTGCTTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937288842 Original CRISPR TTCCCAACACACTCCCAAAC AGG (reversed) Intronic
No off target data available for this crispr